Study of the mechanisms of acupuncture and moxibustion treatment for ulcerative colitis rats

Wu HG, Zhou LB, Pan YY, Huang C, Chen HP, Shi Z, Hua XG

Subject headings  colitis, ulcerative/therapy; acupuncture an d moxibustion therapy; gene expression; cytokines; interleukin-1β; interleukin -6

Wu HG, Zhou LB, Pan YY, Huang C, Chen HP, Shi Z, Hua XG.

Study of the mecha nisms of acupuncture and moxibustion treatment for ulcerative colitis rats in view of the gene expression of cytokines. World J Gastroentero,1999;5(6):515-517

Abstract

AIM  To observe the effect of acupuncture and moxibustion on the expression of IL-1β and IL-6 mRNA in ulcerative colitis rats.

METHODS  The SD rat ulcerative colitis model was created by imm unological method associated with local stimulation. Colonic mucosa was prepared  from human fresh surgical colonic specimens, homogenized by adding appropriate amount of normal saline and centrifuged at 3000r/min. The supernatant wa s collected for measurement of protein conentration and then mixed with Freund a djuvant. This antigen fluid was first injected into the plantae of the model gro up rats, and then into their plantae, dorsa, inguina and abdominal cavities (no Freund adjuvant for the last injection) again on the 10th, 17th, 24th and 31st day. When a certain titer of serum anti-colonic anti body was reached, 2% formalin and antigen fluid (no Freund adjuvant) were admini stered separately by enema. The ulcerative colitis rat model was thus set up. Th e animals were randomly divided into four groups: model control group (MC, n =8), electro-acupuncture group (EA, n=8), herbs-partition moxibustion grou p (HPM 8), normal control group (NC, n=8). HPM: Moxa cones made of refined m ugwort floss were placed on the medicinal pad (medicinal pad dispensing: Radix  Aconiti praeparata, cortex Cinnamomi, etc) for Qihai (RN 6) and Tianshu (S T 25, bilateral) and ignited. Two moxa cones were used for each acupoint once a day and 14 times in all. EA: Tianshu (bilateral) and Qihai were stimulated by th e intermittent pulse with 2Hz frequency, 4mA intensity for 20 minutes once a day  and 14 times in all. After treatment, rats of all four groups were killed simul taneously. The spleen was separated and the distal colon was dissected. Total ti ssue RNA was isolated by the guanidinium thiocyanate phenol-chloroform extracti on method. RT-PCR technique was used to study the expression of IL-1β and IL-6 mRNA.

RESULTS  IL-1β and IL-6 mRNAs were not detect ed in the spleen and colonic mucosa of the NC rats, whereas they were significan tly expressed in that of the MC rats. IL-1β and IL-6 mRNAs we re markedly lower in the EA and HPM rats than that in MC rats. There was no sign ificant difference between the levels of IL-1β and IL-6 mRNAs  in the EA and HPM rats. The expressions of IL-1β and IL-6 mRNAs were nearly the same in the spleen and colon of all groups.

CONCLUSION  Acupuncture and moxibustion greatly inhibited the e xpression of IL-1β and IL-6 mRNA in the experimental ulcerati ve colitis rats.
——————————————————————————————————————————————————————

Ulcerative colitis (UC) is a nonspecific inflammatory bowel disorder of unknown etiology but associated with immunological abnormalities[1]. The cytokines, involved in the regulation of the immune response, play important roles in the pathogenesis of UC. Especially the interleukin-1β (IL-1β) and interleukin -6 (IL-6), inflammatory mediators released by lymphocytes, monocytes and macro phages, are intricately linked with the initiation and propagation of the inflam matory reaction in UC[2]. Both clinical and experimental researches indic ated that acupuncture and moxibustion had good therapeutic effects on UC. The me chanism of such effects may be related to its immunoregulation, but the role of cytokines in it has not been reported. In this study, a UC rat model was establi shed by immunological method to observe the effect of acupuncture and moxibustio n on the expression of IL-1β and IL-6 mRNA in spleen and colo nic mucosa of model rats, in order to clarify the possible mechanism of acupunct ure and moxibustion on UC.

MATERIALS AND METHODS

Material
Male SD rats weighing, 140g±20g, were provided by The Experimental Animal Center of Shanghai University of TCM. The rats were randomly divided into  the model group (n=24) and normal control group (NC, n=8). We consulted  the Methodology of Pharmacy and created the rat model by immunological method a ssociated with local stimulation (refer to the Abstract). These models were randomly subdivided into three groups after being created: model control group (MC , n=8), electro-acupuncture group (EA, n=8) and herbs-partition moxibu stion group (HPM, n=8). The points Qihai (CV6) and bilateral Tianshu (ST25) were located on analogy of person′s points. HPM: Moxa cones made of refined mug wort floss were placed on the medicinal pad (medicinal pad dispensing: Radix A coniti praeparata, cortex Cinnamomi, etc) for Qihai (RN 6) and Tianshu (ST 25,  bilateral) and ignited. Two moxa cones were used for each acupoint once a day a nd 14 times in all. EA: Tianshu (bilateral) and Qihai were stimulated by the int ermittent pulse with 2Hz frequency, 4mA intensity for 20 minutes once a day and 14 times in all. After treatment, all rats of the four groups were killed simula taneously. The spleen was separated and the distal colon 6cm long was diss ected and reserved in liquid nitrogen.

Method
According to the reference[3], total tissue RNA was isolated by the guanidinium thiocyanate phenolchloroform extraction method. The concentration of  sample RNA was measured with ultraviolet spectrophotometer OD260; the integrity  of RNA was identified by agarose (sepharose) gel (10?g/?L) eletrophoresis.
Two μg total RNA was reverse transcribed to cDNA, 20μL reverse transcription reaction system (Promega), which compr ised 10× reverse transcription buffer solution 2μL, 25mmol/L MgCl2 4μL, 4×dNTPs (10mmol/L for each) 2μL, RNAase inhibitor 0.5μL (20U), AMV reverse transcriptase 0.65μL(15U), oligomer (dT)15 and primer 1μL (0.5μg); added DEPC up to 20μL, well mixed, placed in 42℃  water for 40 minutes, heated in 95℃ water for 5 minutes to deactivate reverse transcriptase, and then preserved at -20℃.
According to the reference[4], the primer was synthesized in the oncogene laboratory of the Cell Institute of the Chinese Academy of Sciences. The sequence of IL-1β was ATAGCAGCTTTCGACAGTGAG (sense chain), GTCAACT ATGTCCCGACCATT (antisence chain) 748bp; IL-6, TTCCCTACTTCACAAGTC (sense c hain), CTAGGTTTGCCGAGTAGA (antisense chain) 567bp; glyceraldehyde dehydrog enase (GAPDH) triphosphate, TGAAGGTCGGTGTCAACGGATTTGTC (sense chain), CAGTAGGCCA TGAGGTCCACCAC (antisense chain) 983bp. GAPDH as house keeping gene monitor s the consumption of RNA and eliminates the errors among samples.The total 50μL PCR reaction system consisted of 10×amp lification buffer solution 5μL, 4×dNTPs (2.5mmol/ L for each) 4μL, primers of sense chain and antisense chain 50pmol for each, 2μL reverse transcripti on product, Taq- DNA polymerase 2.5U, and added ddH2O up to 50μL, to mix them together. After 10 second centrifugation,50μL liquid paraffin was added and placed in PCR Gene Amp Mach ine (Pharmacia). The amplification condition: IL-1β∶94℃ pre- denature 4min, 94℃ 30s, 50℃ 45s, 72℃ 90s for 30 cycles; IL-6 and GAPDH: 94℃ pre-denature 4min, 94℃ 1min, 52℃ 1min, 72℃ 1min for 30 cycles.
Ten μL PCR product was added to 6×electrophoresis buffer sol ution 2μL, and underwent agarose gel (1.5g/L,  containing Ethdium bromide 0.5mg/L) electrophoresis at 100V for 1 hour and photographed under ultraviolet lamp.

RESULTS

Total RNA extraction
The ratios of OD260/OD280 of the total RNA samples were between 1.70-2.00 a nd two bands, 18s and 28s, were shown in electrophoresis, indicating that the t otal RNA was not polluted and degraded.

IL-1β and IL-6 mRNA in spleen and colon mucosa
IL-1β and IL-6 mRNA expressions of spleen and colon mucosa  were observed in model control group, electro- acupuncture group and herbs-par tition moxibustion group, but the degrees of expression in EA or HPM were lower than that in MC. There was no significant difference between EA and HPM, but the degree of expression in HPM as a whole tended to be less. The expressions of spleen and colon mucosa in all groups were nearly the same. Neither IL-1β nor IL-6 mRNA expression of spleen and colon mucosa could be observed in the normal control group.
a, b, c,
The effect of acupuncture and moxibustion o n IL-1β and IL-6 mRNA expression in spleen and colonic mucosa of ulcerative c olitis rats.M: Sign of PCR (Hua Mei), 1543, 994, 694, 515, 377 and 237bp from up to down re spectively. 1, 3, 5 and 7 are mRNA of colonic mucosa in MC, EA, HPM and NC grou ps respectively; 2, 4, 6 and 8 are mRNA of spleen in MC, EA, HPM and NC groups respectively.

DISCUSSION
The pathogenesis of UC may involve in both local and systemic immunological abnormalities. Cytokines now have attracted special attention by virtue of their participation in the intestinal inflammation and immune reactions. IL-1β and Il-6, as important inflammatory factors and immune regulators, play a fundamental role in the pathogenesis of UC. Many studies showed increased IL-1β and IL-6 levels in the colonic mucosa and peripheral blood of patients with UC, and indicated that IL-6 was possibly correlated with the severity of the manifestations in U C patients[5,6]. IL-1β and IL-6, produced mainly by a ctivated phagocytes and lymphocytes, show a wide variety of biological functions . They can influence secretion of other cytokines and inflammatory mediators in an autocrine or paracrine fashion, induce expression of surface immune molecules  of antigen-presenting cells to serve as an activation factor and differentiati on factor on T cells and B cells, mediate immunoglobulin secretion, activate the  complements, killer cells and phagocytes, and enhance tissue injury mediated by  cellular and humoral immune reactions. In addition, IL-1β and  IL-6 can promote the expression of adhesion molecules on endothelial-leukocyt e and are regarded as a chemoattractant of circulating neutrophils to migrate in to the inflammed site, thus causing a series of longlasting intestinal inflamm atory reaction and tissue injury[7-9].
This study demonstrated that IL-1β and IL-6 were undetectable in the spleen and colonic mucosa of the normal control rats, whereas they were significantly expressed in that of the model control rats. Lymphocytes and monocytes/macrophages in the rats were activated by persistent stimulation of exogen ou s antigens which might contribute to the expression of cytokines. The amount of IL-1β and IL-6 mRNA was nearly the same between the spleen and colon in different groups, suggesting that immunocytes in the spleen and colon responded to the antigen in a similar way and interacted through the pathway of cytokines. In our study the markedly decreased expressions of IL-1β and Il-6 mRNA in EA and HPM suggested that acupuncture and moxibustion could inhibit the expression of infla mmatory cytokines in UC model rats, regulate the immunological abnormalities, re duce immunocyte response to inflammation, and then contribute to the elimination  of inflammation and repair of tissue.
The pathogenesis of UC may be due to an imbalance between inflammatory cytokines on one hand and antiinflammatory immune factors such as IL-4, IL-1ra, IL-1 0, etc on the other. Our results suggest that in addition to inhibit the express ion of inflammatory cytokines, acupuncture and moxibustion can activate the ant i-inflammatory factors, but further studies are needed.

REFRENCES
1  Kusugami K, Fukatsu A, Tanimoto M, Shinoda M, Haruta J, Kuroiwa A.Elevation of interleukin 6 in inflammatory bowel disease
in macrophage and epithelial cell dependent. Dig Dis Sci, 1995;40:949-959
2  Hyams JS, Fitzgerld JE, Treem WR, Wyzga N, Kreutzer DL. Relationship of functional and antigenic interleukin 6 to disease
activity in inflammatory bowel disease. Gastroenterology, 1993;104:1285-1292
3  Chomczynski P,SacchiN.Single step method of RNA isolation by acid guanidinium thiocyanate phenol chlorlform extraction.
Anal Biochem, 1987,162:156-159
4  Murphy PG, Grondin J, Altares M, Richardson PM. Induction of interleukin 6 in axotomized sensory neurons.
J Neurosci, 1995;15:5130-5138
5  Mitsuyama K, Toyonaga A, Sasaki E, Ishida O, Ikeda H, Tsuruta O. Soluble interleukin 6 receptors in inflammatory bowel
disease: relation to circulating interleukin 6. Gut, 1995;36:45-49
6  Stevens C, Walz G, Singaram C, Lipman ML, Zanker B, Muggia A. Tumor necrosis factorα, interleukin 1β, and interleukin 6,
expression in inflammatory bowel disease. Dig Dis Sci, 1992;37:818-826
7  Hogaboam CM, Snider DP, Collins SM. Cytokine modulation of T lymphocyte act ivation by intestinal smooth muscles cells.
Gastroenterology,1997;112:1986-1997
8  Nassif A, Longo WE, Mazuski JE, Vemava AM, Kaminski DL. Role of cytokines andplatelet activating factor inflammatory
bowel disease. Dis Colon Rectum, 1996;39:217-223
9  Schreiber S, Raedler A, Stenson WF, MacDermott RP. The role of the mucosal immune system in inflammatory bowel
disease. Gastroenterol Clin North Am,1992;21:451-502
——————————————————————————–

Shanghai Institute of Acupuncture-Moxibustion and Meridians, Shanghai 2 00030, China
Dr. WU Huan-Gan, male, born on 1956-11-21 in Xianju County, Zhejiang Province, graduated from Zhejiang College of Traditional Chinese Medicine, with Master Degree in 1990, and from Shanghai University of Traditional Chinese Medic ine with Doctoral Degree in 1993; now professor, director, majoring the research  of acupuncture-moxibustion immunity, having 26 papers published.
Supported by the National Natural Science Foundation of China, No.396 70899.
Correspondence to:  Prof. WU Huan-Gan, Shanghai Institute of Ac upuncture-Moxibustion and Meridians, 650 South Wan Ping Road, Shanghai 200030, China
Tel.+86·21·64395972
Received  1999-05-23